Review



636568 trans blot turbo rta midi  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa 636568 trans blot turbo rta midi
    636568 Trans Blot Turbo Rta Midi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/Human+Brain%2C+Insula+Total+RNA/pm42102814-194-0-31
    Average 94 stars, based on 2 article reviews
    636568 trans blot turbo rta midi - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications
    Article Snippet: Quantitative real-time polymerase chain reactions (qPCRs) were carried out on a StepOnePlus system (Applied Biosystems, Massachusetts, EUA), utilizing pre-designed intron-spanning primers (Sigma-Aldrich, Saint Louis, MO, USA) ( ). .. In brief, a total of 10 ng cDNA was added to each reaction in addition to 5 μL of Fast SYBR Green Reagent, 1 μL of forward primer, 1 μL of reverse primer, and 2.5 μL of molecular biology grade water. cDNA synthesized in-house from Total Human RNA (Clontech) served as the positive control in this study. ..

    Synthesized:

    Article Title: Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications
    Article Snippet: Quantitative real-time polymerase chain reactions (qPCRs) were carried out on a StepOnePlus system (Applied Biosystems, Massachusetts, EUA), utilizing pre-designed intron-spanning primers (Sigma-Aldrich, Saint Louis, MO, USA) ( ). .. In brief, a total of 10 ng cDNA was added to each reaction in addition to 5 μL of Fast SYBR Green Reagent, 1 μL of forward primer, 1 μL of reverse primer, and 2.5 μL of molecular biology grade water. cDNA synthesized in-house from Total Human RNA (Clontech) served as the positive control in this study. ..

    Positive Control:

    Article Title: Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications
    Article Snippet: Quantitative real-time polymerase chain reactions (qPCRs) were carried out on a StepOnePlus system (Applied Biosystems, Massachusetts, EUA), utilizing pre-designed intron-spanning primers (Sigma-Aldrich, Saint Louis, MO, USA) ( ). .. In brief, a total of 10 ng cDNA was added to each reaction in addition to 5 μL of Fast SYBR Green Reagent, 1 μL of forward primer, 1 μL of reverse primer, and 2.5 μL of molecular biology grade water. cDNA synthesized in-house from Total Human RNA (Clontech) served as the positive control in this study. ..

    other:

    Article Title: Expression and localization of P1 promoter-driven hepatocyte nuclear factor-4α (HNF4α) isoforms in human and rats
    Article Snippet: Four out of five RNA samples prepared from pools of human RNA were purchased from Clontech (Palo Alto, CA).



    Similar Products

    99
    ATCC rna extraction human ovarian cancer cell lines skov3
    Rna Extraction Human Ovarian Cancer Cell Lines Skov3, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/SK-OV-3/10__3390_slash_bioengineering13060597-49-5-20
    Average 99 stars, based on 1 article reviews
    rna extraction human ovarian cancer cell lines skov3 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    94
    TaKaRa 636568 trans blot turbo rta midi
    636568 Trans Blot Turbo Rta Midi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/Human+Brain%2C+Insula+Total+RNA/pm42102814-194-0-31
    Average 94 stars, based on 1 article reviews
    636568 trans blot turbo rta midi - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Human Protein Atlas human protein atlas hpa rna celline
    Human Protein Atlas Hpa Rna Celline, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/data+rna+seq/pm42258538-90-9-6
    Average 86 stars, based on 1 article reviews
    human protein atlas hpa rna celline - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Biosearch Technologies Inc human lnc122 rna transcripts
    Human Lnc122 Rna Transcripts, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/human+lnc122+rna+transcripts/pm42250762-121-31-45
    Average 86 stars, based on 1 article reviews
    human lnc122 rna transcripts - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    10X Genomics rna adt human lymph node dataset
    Rna Adt Human Lymph Node Dataset, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/crlm+dataset+human+scrna+seq/pm42114120-103-13-20
    Average 86 stars, based on 1 article reviews
    rna adt human lymph node dataset - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    rna  (ATCC)
    96
    ATCC rna
    Rna, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/Human+coronavirus+229E/pmc13149225-82-8-15
    Average 96 stars, based on 1 article reviews
    rna - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Sangon Biotech human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat
    Human Slc7a1 1 Rna Primers F Tcctgctttggctccatgaacg R Agaggagtgtgcttgcggacat, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/apoa1+biotech+ccctgggatcgagtgaagga+f+gcaggtaatcccaaaagcgac+primer+r+sangon/pmc13019507-95-0-10
    Average 86 stars, based on 1 article reviews
    human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech human nfe2l2 nrf2 rna primers f tccagtcagaaaccagtggat r gaatgtctgcgccaaaagctg
    Human Nfe2l2 Nrf2 Rna Primers F Tccagtcagaaaccagtggat R Gaatgtctgcgccaaaagctg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/cas9+plasmid+puromycin+recombinant+sgrna/pmc13019507-94-0-9
    Average 86 stars, based on 1 article reviews
    human nfe2l2 nrf2 rna primers f tccagtcagaaaccagtggat r gaatgtctgcgccaaaagctg - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca
    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Human Slc31a1 Rna Primers F Ccaggaccaaatggaaccatcc R Accacctggatgatgtgcagca, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+rna/apoa1+biotech+ccctgggatcgagtgaagga+f+gcaggtaatcccaaaagcgac+primer+r+sangon/pmc13019507-93-0-9
    Average 86 stars, based on 1 article reviews
    human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

    Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

    Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

    Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

    Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

    Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

    SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining